SUMO targets the APC/C to regulate transition from metaphase to anaphase

0
40


Plasmids

To create the inducible SAE knockdown constructs, forward (FW) and reverse (RV) oligonucleotide sequences were designed to contain either a scrambled shRNA or a target shRNA sequence flanked by BbsI and XhoI restriction sites: ishControl_FW:TCCCGAGGATAGACGCTTTAAATAATTCAAGAGATTATTTAAAGCGTCTATCCTCTTTTTC,ishControl_RV:TCGAGAAAAAGAGGATAGACGCTTTAAATAATCTCTTGAATTATTTAAAGCGTCTATCCTC,ishSAE1_FW:TCCCGCTATGTTGGTCCTTTGTTTATTCAAGAGATAAACAAAGGACCAACATAGCTTTTTC,ishSAE1_RV:CTCGAGAAAAAGCTATGTTGGTCCTTTGTTTATCTCTTGAATAAACAAAGGACCAACATAGC,ishSAE2.1_FW:TCCCGCTGTATTGAAAGTAGGAATATTCAAGAGATATTCCTACTTTCAATACAGCTTTTTC,ishSAE2.1_RV:CTCGAGAAAAAGCTGTATTGAAAGTAGGAATATCTCTTGAATATTCCTACTTTCAATACAGC,ishSAE2.2_FW:TCCCGCACCAGATGTCCAAATTGAATTCAAGAGATTCAATTTGGACATCTGGTGCTTTTTC,ishSAE2.2_RV:CTCGAGAAAAAGCACCAGATGTCCAAATTGAATCTCTTGAATTCAATTTGGACATCTGGTGC). FW and RV oligonucleotides were annealed and ligated into the pH1tet-flex backbone64 digested by BbsI and XhoI restriction enzymes (Biolabs). Plasmids for the scrambled shRNA were digested with PacI restriction enzyme (Biolabs) and ligated into the PacI digested and dephosphorylated FH1t_UTG backbone64. Plasmids for the target shRNAs were digested with NheI and BstBI restriction enzymes (Biolabs) and ligated into the NheI and BstBI digested and dephosphorylated FH1t_UTG_Neo backbone. Constitutive knockdown of SAE2 and UBC9 in HCT116 and HT-1080 cells was achieved by the expression of the following shRNAs: shSAE2.1:CCGGGCTGTATTGAAAGTAGGAATACTCGAGTATTCCTACTTTCAATACAGCTTTTT,shSAE2.2:CCGGGCACCAGATGTCCAAATTGAACTCGAGTCAATTTGGACATCTGGTGCTTTTT,shUBC9.1:CCGGGCCTACACGATTTACTGCCAACTCGAGTTGGCAGTAAATCGTGTAGGCTTTTT,shUBC9.2:CCGGTGGAGGAAAGACCACCCATTTCTCGAGAAATGGGTGGTCTTTCCTCCATTTTT.

Knockdown of endogenous APC4 was performed using the following shRNA:

CCGGGCTGGTACTTGTCTTGCATTACTCGAGTAATGCAAGACAAGTACCAGCTTTTT.

The cDNA of ANAPC4 was obtained from Invitrogen/Life Technologies (ultimate ORF clone IOH54154) in the donor vector pENTR221. For fusions with an N-terminal V5-tag, the cDNA was cloned into pcDNA3.1/nV5-DEST using standard GATEWAY technology (Invitrogen). N-terminal GFP-fusions were obtained by GATEWAY cloning into the retroviral vector pBabe-GFP-puro-DEST (a kind gift of M. Timmers and P. de Graaf, Utrecht, The Netherlands). Mutants of APC4 were produced via site-directed mutagenesis of the entry clone.

Inducible constructs of APC4 WT and APC4 K772,798R mutant were obtained by GATEWAY cloning into pCW57.1. Resistance to the shRNA against APC4 was achieved via site-directed mutagenesis of the APC4 entry clones.

The pHIS-TEV30a-3xSUMO2 construct was a kind gift of Dr. R.T. Hay65. The N-terminal His6-tag was changed into a His10-tag by site-directed mutagenesis. The pBIOBS-KIF18B-Flag construct was published previously45. Constructs to purify a His-tagged fragment of Hsl1 (aa 667-872) and His-tagged UbcH1066 were a kind gift from Dr. J.M. Peters, Vienna, Austria.


Cell lines and cell culture

HT-1080, HCT116, and U2OS cells were obtained from ATCC and HeLa cells originated from the laboratory of René Medema at the Netherlands Cancer Institute. All cell lines have been authenticated via STR profiling using 10 different markers and have been tested to be free of mycoplasma.

HCT116 cells were cultured in 45% RPMI1640+Glutamax (Gibco, Invitrogen Corporation, Grand Island, NY, USA), 45% Dulbecco’s modified Eagle’s medium/F12 (Gibco) and 10% fetal calf serum (FCS; Gibco), complemented with 100 U ml−1 penicillin and 100 mg ml−1 streptomycin (Gibco). HeLa, U2OS, and HT-1080 cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) including 10% FCS (Gibco) and 100 U ml−1 penicillin and 100 mg ml−1 streptomycin (Gibco). HeLa cell lines for inducible knockdown were cultured in the same medium supplemented with 300 µg ml−1 Geneticin (G418; Life technologies). To induce the expression of the shRNAs, these HeLa cell lines were treated with 10 ng ml−1 doxycycline for the indicated amount of time. For inhibition of the NEDD8-activating enzyme, HeLa cells were treated with 1 µM MLN4924 for 16 h. Heat shock was done for 75 min at 43 °C. For recovery samples, the cells were heat shocked as above but then put back at 37 °C for 2 h before lysing.


Antibodies

The following primary antibodies were used at a dilution of 1:1000: rabbit anti-APC2 (Cell Signaling Technology, CST12301), rabbit anti-CUL4A (Bethyl, A300-739A), rabbit anti-APC4 (Bethyl, A301-176A), rabbit anti-V5 (Abcam, ab9116), mouse anti-SUMO2/3 (Abcam, ab81371), mouse anti-SUMO2/3 (MBL-Sanbio, M114-3), rabbit anti-GFP (Sigma, 1814460), mouse anti-His (Sigma, H1029), rabbit anti-SART1 (custom-made by Eurogentec)67, rabbit anti-CDC27 (Santa Cruz, sc9972), rabbit anti-CDH1, rabbit anti-Hsl1 and rabbit anti-APC11 (kind gifts from Dr. J.M. Peters, Vienna)66, rabbit anti-KIF18B (Bethyl, A303-982A), and rabbit anti-Securin (Cell Signaling Technology, CST13445).


Transfection of cells and virus infection

Cells were transfected at 60% confluency in a 15-cm dish with 24 µg plasmid DNA and 60 µg polyethylenimine (Alfa Aesar). Cells were infected with lentivirus and retrovirus at a multiplicity of infection (MOI) of 3. To obtain stable cell lines, selection was started 24 h after infection using 600 µg ml−1 Geneticin (G418; Life Technologies) for the inducible knockdown of SAE and 2.5 µM puromycin (Calbiochem) for cells infected with the retroviral GFP-APC4 constructs. To analyze the knockdown of KIF18B, HeLa cells were transfected with 20 nM of control siRNA (#D-001210-01-05, Dharmacon) or siRNA against KIF18B (#J-010460-11-0005, Dharmacon) by mixing the siRNAs with 200 µl Optimem (#31985070, Life Technologies) and 5 µl Dharmafect (#T-2001-02, GE Life Sciences), incubating for 20 min at room temperature, complementing with 1.6 ml Dulbecco’s modified Eagle’s medium (Gibco) including 10% FCS (Gibco), and adding the mix to the cells. Cells were lysed in SNTBS (2% sodium dodecyl sulfate (SDS), 1% N-P40, 50 mM Tris pH 7.5, 150 mM NaCl) for western blot analysis 72 h after transfection.


Microscopy

In case of the inducible SAE knockdown, stable HeLa cell lines were plated on day 0 in six-well plates. Knockdown of the target protein was induced by adding medium containing 10 ng ml−1 doxycycline on day 1. Cells were split on day 3 onto coverslips in 24-well plate wells for microscopy and into 6-well plate wells for immunoblot analysis to confirm knockdown efficiency. On day 4, cells on coverslips were fixed with 3.7% formaldehyde in phosphate-buffered saline (PBS) for 15 min at room temperature and washed five times with PBS. Cells were dehydrated by subsequently washing the coverslips for 1 min with 70%, 90%, and 100% ethanol. Finally, coverslips were dried and placed on a slide using ProLong Gold (Life Technologies) containing 5 µg ml−1 Hoechst 33258 (Life Technologies). Cells in 6-well plates were lysed in SNTBS (2% SDS, 1% N-P40, 50 mM Tris pH 7.5, 150 mM NaCl) for western blot analysis. To analyze the constitutive knockdown of SAE2 and UBC9 in HCT-116 and HT-1080 cells, cells were plated onto coverslips in 24-well plate wells for microscopy and into 6-well plate wells for immunoblot analysis to confirm knockdown efficiency 1 day after lentivirus infection. After 48 h, cells on coverslips were fixed and stained for microscopy as described above and samples for immunoblot analysis were lysed in SNTBS.


Live cell imaging to analyze knockdown of SAE1

Stable HeLa cell lines were plated on day 0 in six-well plates. Knockdown of the target protein was induced by replacing the medium with medium containing 10 ng ml−1 doxycycline on day 1. After 40 h of induction, cells were split into 8-well glass bottom dishes (Labtek). Six hours later, SiR-DNA (Spirochrome) was added at a final concentration of 250 nM in Leibovitz L15 CO2-independent medium (Gibco). After 2 h incubation, live cell imaging was started on a DeltaVision microscope (Deltavision Elite; Applied Precision). Images were acquired every 5 min using a 20× NA 0.25 air objective (Olympus) and a high-resolution CCD camera (Coolsnap HQ2; Photometrics). Z-stacks were acquired with 3.33 μm intervals. Images were processed using Softworx (Applied Precision) and Image J software. Projections of Z-stacks were made and analyzed by marking the frames of NEB metaphase, and anaphase for each cell going through mitosis. Subsequently, the amount of time needed from NEB until metaphase and from metaphase until anaphase was calculated for each dividing cell. Averages and standard deviations were calculated for >200 cells per condition resulting from three independent experiments. Statistical analysis was performed using a two-sided Student’s t-test.


Live cell imaging in rescue experiment

HeLa cells expressing GFP-tagged Histone 2B68 and harboring an inducible construct of either APC4 WT or APC4 K772,798R mutant were seeded in a 6-well plate (125,000 cells per well). On day 2, expression of the APC4 constructs was induced by adding medium containing 10 ng ml−1 doxycycline and cells were infected with lentivirus expressing either a control shRNA or an shRNA raised against APC4 at an MOI of 3. Cells were split for microscopy into a 24-well plate on day 3 (40,000 cells per well) and subjected to live cell imaging on day 4. The amount of time needed for the dividing cell to proceed from metaphase to anaphase onset was monitored. SEMs were calculated for 70 cells per condition and statistical analysis was performed using a two-sided Student’s t-test.


Electrophoresis and immunoblotting

Protein gel electrophoresis was performed by SDS-polyacrylamide gel electrophoresis (PAGE) using either home-made gels and Tris-glycine buffer or Novex 4–12% Bis-Tris gradient gels (Invitrogen) and MOPS buffer. Immunoblotting was performed using Hybond-C extra membranes (Amersham Biosciences) and a wet blot system (Invitrogen) and protein amounts were detected by Ponceau S staining (Sigma). After blocking the membrane with PBS containing 8% milk powder and 0.05% Tween 20, it was incubated with the primary antibodies as indicated. Uncropped blots are shown in Supplementary Fig. 8.


Silverstain

Proteins separated on a Novex 4–12% Bis-Tris gradient gel (Invitrogen) were fixed for 2 h in 50% methanol, 12% acetic acid, and 0.05% formalin, and the gel was washed three times with 35% ethanol for 20 min each. Afterwards, the gel was sensitized with 0.02% Na2S2O3 and washed three times with MQ water for 5 min each. Proteins were stained with 0.2% AgNO3 and 0.076% formalin for 20 min and the gel was washed again twice with MQ water. To develop the gel, it was incubated with 6% Na2CO3, 0.05% formalin, and 0.0004% Na2S2O3 for approximately 5 min. The development was stopped by adding 50% methanol and 12% acetic acid for 5 min. The gel was stored in 1% acetic acid in the dark.


Purification of His-SUMO2 conjugates

Purification of His-SUMO2 conjugates was performed as follows25. Cells expressing His-SUMO-2 were washed and collected in ice-cold PBS. Small aliquots of cells were lysed in 1× LDS for total lysates samples. Guanidinium lysis buffer (6 M guanidinium-HCl, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris/HCl, pH 8.0, and competing imidazole) was added to the cell pellet to lyse the cells, after which the cell lysates were sonicated to reduce the viscosity. These lysates were used to determine the protein concentration using the BCA Protein Assay Reagent (Thermo Scientific); lysates were equalized and His-SUMO-2 conjugates were enriched on nickel-nitrilotriacetic acid-agarose beads (Qiagen) after which the beads were washed using wash buffers A to D. Wash buffer A: 6 M guanidinium-HCl, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris/HCl, pH 8.0, 10 mM imidazole, pH 8.0, 5 mM β-mercaptoethanol, 0.2% Triton X-100. Wash buffer B: 8 M urea, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris/HCl, pH 8.0, 10 mM imidazole, pH 8.0, 5 mM β-mercaptoethanol, 0.2% Triton X-100. Wash buffer C: 8 M urea, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris/HCl, pH 6.3, 10 mM imidazole, pH 7.0, 5 mM β-mercaptoethanol, 0.2% Triton X-100. Wash buffer D: 8 M urea, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris/HCl, pH 6.3, 5 mM β-mercaptoethanol, 0.1% Triton X-100. Samples were eluted in 7 M urea, 0.1 M Na2HPO4/NaH2PO4, 0.01 M Tris/HCl, pH 7.0, 500 mM imidazole.


Crosslinking of antibody

The CDC27 antibody was incubated overnight with Protein A beads at 4 °C. Prebleed serum was used as a negative control and incubated with Protein A beads in a similar manner. The beads were then washed two times with PBS and two times with 0.1 M sodium borate, pH 9 before incubating with 20 mM DMP (dimethyl pimelimidate dihydrochloride; D8388 Sigma) in 0.1 M sodium borate for 45 min at 4 °C. Incubation was repeated with fresh DMP solution for another 45 min at room temperature. Crosslinking was stopped by incubating twice for 10 min with 200 mM Tris pH 7.5 and 150 mM NaCl. The beads were washed twice with 50 mM glycine, pH 2.5 and 4 times with PBS plus 0.1% Tween 20 and stored as a 50% slurry in PBS plus 0.1% Tween 20 at 4 °C.


Purification of endogenous APC/C

CDC27 antibody (65 µg) was coupled to 50 µl Protein A beads as described above. One gram of HeLa cells was resuspended in 1 ml of lysis buffer (20 mM Tris pH 7.5, 150 mM NaCl, 2 mM EDTA, 0.05% Tween 20, 5% glycerol) and lysed using a dounce homogenizer. After centrifuging for 30 min at 20000 × g and 4 °C, the supernatant was incubated with CDC27 antibody coupled Protein A beads for 1 h at 4 °C. Beads were then washed four times with 20 mM Tris pH 7.5, 150 mM NaCl, 0.05% Tween 20, and 5% glycerol. The APC/C was eluted in elution buffer (20 mM Tris pH 7.5, 150 mM NaCl, 0.05% Tween 20, 2.5% glycerol, 1 mg ml−1 CDC27 peptide).


Purification of the APC/C via GFP-trap

One gram of HeLa cells expressing GFP-APC WT and GFP-APC4 K772,798R mutant was lysed in a similar manner as described for the endogenous complex. Lysates were incubated with 20 µl GFP-trap (Chromotek) and incubated for 1 h at 4 °C. Beads were washed four times in 20 mM Tris pH 7.5, 150 mM NaCl, 0.05% Tween 20, and 5% glycerol and proteins were eluted in 2× NuPAGE LDS sample buffer (Thermo Fisher Scientific).


Purification of recombinant proteins

His10-tagged 3xSUMO2 was recombinantly expressed in BL21 cells by inducing protein expression at an OD600 of 0.6 with 0.5 mM IPTG and incubating overnight at 25 °C. Cells were lysed in 50 mM HEPES pH7.6, 0.5 M NaCl, 25 mM MgCl2, 20% glycerol, 0.1% N-P40, 50 mM imidazole, 1 mM phenylmethanesulfonylfluoride (PMSF), and protease inhibitor cocktail –EDTA (Roche), and the His-tagged 3xSUMO construct was purified from cells by incubating with Ni-NTA beads (Qiagen) for 3 h at 4 °C. Beads were then washed twice in lysis buffer including PMSF and protease inhibitor cocktail and twice in lysis buffer without PMSF and protease inhibitor cocktail. Proteins were eluted by incubating with lysis buffer plus 500 mM imidazole for 10 min at 4 °C. The elution step was repeated three times. Recombinant APC/C and Securin were kind gifts from Dr. B.A. Schulman (St. Jude Children’s Research Hospital, Memphis, TN) and were purified69,70. Recombinant APC/C, containing a C-terminal Twin Strep-tag on APC4, was expressed in insect cells, and purified with a three-step scheme: (1) affinity purification with Strep-Tactin Sepharose (IBA Life Sciences), (2) anion exchange chromatography, and (3) size exclusion chromatography (SEC). Securin (C197, 198A) was expressed in BL21(DE3) Codon Plus (RIL) cells as an N-terminal GST-TEV and C-terminal Cys-His6 fusion and purified by glutathione affinity chromatography, proteolytic TEV cleavage, nickel affinity chromatography, and SEC.


In vitro SUMOylation of endogenous APC/C

After immunoprecipitation, the endogenous APC/C was SUMOylated on the beads by incubating with 1.2 µg SAE1/2, 4 µg UBC9, 8 µg SUMO-3 or SUMO-2 allKR mutant, 50 mM Tris pH 7.5, 5 mM MgCl2, 2 mM ATP, 3.5 U ml−1 Creatine kinase, 10 mM Creatine phosphate, 0.6 U ml−1 inorganic pyrophosphate, and protease inhibitor cocktail (Roche) in a 50 µl reaction for 3 h at 4 °C. A similar protocol was used to SUMOylate the APC/C exhibiting GFP-tagged APC4 bound to GFP-trap in vitro.


Ubiquitylation assays with endogenous APC/C

For in vitro ubiquitylation assays with endogenous APC/C, the SUMOylation machinery was removed by washing the beads three times with 20 mM Tris pH 7.5, 150 mM NaCl, 0.05% Tween 20 and 5% glycerol and 1 µg of CDH1 and 1.15 µg of an Hsl1 fragment (aa 667–872) were bound to the complex by incubating the beads for 1 h in 0.4% bovine serum albumin (BSA), 0.05% Tween 20, 50 mM Tris pH 7.5, and 150 mM NaCl. After washing another three times, the APC/C was eluted from the beads with 1 mg ml−1 CDC27 peptide in wash buffer for 1 h (1:1 (w/v) ratio). Ubiquitylation of Hsl1 was performed by adding 40 nM UBE1 (Boston Biochem), 0.7 µM UbcH10, 8 µM Ubiquitin (Boston Biochem), 50 mM Tris pH 7.5, 5 mM MgCl2, 2 mM ATP, and 1 mM dithiothreitol (DTT) and incubating at 4 °C.


In vitro SUMOylation of recombinant APC/C

To SUMOylate recombinant APC/C (kind gift of Dr. N. Brown and B.A. Schulman, Memphis, USA) in vitro, 1 µg of the complex was incubated with 160 ng SAE1/2, 2 µg UBC9, 2 µg SUMO2 allKR mutant, 50 mM Tris pH 7.5, 5 mM MgCl2, 2 mM ATP, 3.5 U ml−1 Creatine kinase, 10 mM Creatine phosphate, 0.6 U ml−1 inorganic pyrophosphate, and protease inhibitor cocktail (Roche) for 3 h at 4 °C in a 15 µl reaction. As a negative control, recombinant APC/C WT was treated similarly but leaving out UBC9 from the reaction.


Ubiquitylation assays with recombinant APC/C

To obtain KIF18B as a substrate for the in vitro ubiquitylation reaction, five 15-cm dishes of U2OS cells were transfected with a pBIOBS-KIF18B-Flag construct. Three days after transfection the protein was purified from cells by immunoprecipitation. Cells were lysed in 1 ml of 20 mM Tris pH7.5, 150 mM NaCl, 2 mM EDTA, 0.05% Tween 20, 5% glycerol, sonicated, and centrifuged at 20,000 × g for 30 min at 4 °C. The supernatant was incubated with 30 µl of anti-Flag M2 affinity gel (Sigma) for 2 h at 4 °C, and the beads were washed four times with lysis buffer before eluting the protein with lysis buffer plus 1 mM Flag M2 epitope peptide for 30 min at 4 °C. Apart from KIF18B, recombinant Securin was used as a substrate in in vitro ubiquitylation assays.

For ubiquitylation, 1 µg of CDH1 was added to the SUMOylated APC/C and incubated for 30 min at 4 °C. Afterwards, 1 µg of substrate was ubiquitylated by adding 40 nM UBE1, 0.7 µM UbcH10, 8 µM Ubiquitin, 50 mM Tris pH7.5, 5 mM MgCl2, 2 mM ATP, and 1 mM DTT in a 10 µl reaction and incubating at 4 °C for the indicated amount of time. One µl of 50 µM SENP2 catalytic domain (Boston Biochem) was added to the indicated samples after 2 h of ubiquitylation for an additional hour.


Co-IP of binding partners of the APC/C

Recombinant APC/C WT and APC/C mutant was SUMOylated in vitro by adding 50 mM Tris pH 7.5, 5 mM MgCl2, 2 mM ATP, 3.5 U ml−1 Creatine kinase, 10 mM Creatine phosphate, 0.6 U ml−1 inorganic pyrophosphate, protease inhibitor cocktail (Roche), 6.4 µg SAE1/2, 40 µg UBC9, and 40 µg SUMO-3 to 10 µg samples of APC/C in a volume of 180 µl and incubating for 3 h at 4 °C. The SUMOylated recombinant complex was purified by adding Strep-tactin beads (GE Healthcare) and incubating for 2 h at 4 °C in 50 mM Tris pH 7.5 and 150 mM NaCl. Five 15-cm plates of HeLa cells per sample were lysed in 50 mM Tris pH 7.5, 150 mM NaCl, and 20 mM NEM (Sigma), sonicated to reduce viscosity and centrifuged at 20,000 × g for 30 min at 4 °C. The Strep-tactin beads were washed three times in lysis buffer to eliminate the SUMO machinery and incubated with the supernatant of the HeLa lysates for 2 h at 4 °C. Afterwards the beads were washed three times with 50 mM Tris pH 7.5 and 150 mM NaCl and three times with 50 mM ammonium bicarbonate. The bound proteins were incubated with 2 µg of trypsin on the beads overnight at 37 °C. The samples were then passed through a pre‐washed 0.45 μm filter (Millipore) and acidified with 2% Trifluoroacetic acid (Sigma). For subsequent mass spectrometric analysis, the peptides were desalted by C-18 stage tips36. For western blot analysis, proteins were eluted from beads by incubating with 2xLDS.


Co-IP of binding partners of 3xSUMO2

Five 15-cm dishes of HeLa cells per sample were lysed in 1 ml of 50 mM Tris pH 7.5, 150 mM NaCl, 0.5% NP-40, 50 mM imidazole, sonicated and centrifuged at 20,000 × g for 1 h at 4 °C. The supernatant was incubated with recombinant 3xSUMO2 bound to Ni-NTA beads for 2 h at 4 °C. As a control, HeLa lysate was incubated with Ni-NTA beads without 3xSUMO2. Samples were washed three times with 50 mM Tris pH 7.5, 150 mM NaCl, 0.5% NP-40, 50 mM imidazole and three times with 50 mM Tris pH 7.5, 150 mM NaCl including two changes of tubes. Binding partners of 3xSUMO2 were eluted by incubating with 8 M urea in 50 mM Tris pH 7.5 for 30 min at room temperature. A second elution was performed using 8 M urea, 50 mM Tris pH 7.5, and 500 mM imidazole for 30 min at room temperature.


Binding of 3xSUMO2 to biotinylated peptides

Peptides were synthesized on a SYRO II synthesizer, using preloaded Wang resin and standard Fmoc Solid Phase Peptide Chemistry, with PyBop and Dipea as activator and base and listed in Supplementary Table 2.

Liquid chromatography–tandem mass spectrometric (LC-MS) measurements for peptide synthesis were performed on a system equipped with a Waters 2795 Separation Module (Alliance HT), Waters 2996 Photodiode Array Detector (190–750 nm), Phenomenex Kinetex C18 (2.1× 50, 2.6 μm), and Xevo G2-XS Time of Flight Mass Spectrometer.

For the binding assay, wells of Streptavidin High Capacity Coated Plates (Sigma, 96-well, clear, S6940) were pre-washed three times with 200 µl 1×PBS per well. Peptides were added to the wells overnight at 4 °C at a concentration of 500 pmol ml−1. Afterwards, blocking solution (0.4% BSA in 1×PBS) was added for 30 min at room temperature and the wells were washed three times with 200 µl 1×PBS/0.05%Tween 20. Then the wells were incubated with 50 µl of recombinant 3xSUMO2 (10 µg ml−1) for 90 min at 4 °C. Unbound protein was washed away three times with 200 µl 1×PBS/0.05%Tween 20 and 50 µl of SUMO2/3 mouse monoclonal antibody (dilution 1:48) was added and incubated for 90 min at 4 °C. Wells were washed another three times with 200 µl 1×PBS/0.05%Tween 20 and 50 µl of horseradish peroxidase-coupled anti-mouse secondary antibody (dilution 1:200) was added and incubated for 90 min at 4 °C. Unbound antibody was washed away three times with 200 µl 1×PBS/0.05%Tween 20 and 100 ul of a 1:1 dilution of the reagents A and B in the Color Reagent Pack (R&D Systems) was added to the wells. The plate was incubated at room temperature in the dark until the positive controls were colored and the reaction was stopped with 50 µl 1 M H2SO4 per well. Binding of the peptides was determined by measuring the absorbance at 450 nm in a plate reader (Perkin Elmer Victor X3).


Mass spectrometric analysis

Desalted peptide samples were measured by nanoscale LC‐MS/MS on an Orbitrap Q‐Exactive (Thermo), and raw data analysis was performed using the MaxQuant Software and Perseus Software version 1.5.1.2.


Data availability

The authors confirm that all data supporting the findings of this study are available within the paper and its supplementary information files. The mass spectrometric proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD006335.



Source link

LEAVE A REPLY

Please enter your comment!
Please enter your name here